pst i restriction enzymes (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs pst i restriction enzymes
Pst I Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4951 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pst+i+restriction+enzyme/NdeI/pmc12808494-57-13-17
Average 99 stars, based on 4951 article reviews

pst i restriction enzymes - by Bioz Stars, 2026-10

99/100 stars

Images

Plasmid Preparation:

Article Title: Small molecular weight polyfluoroalkyl phosphonates induce ROS-mediated cytotoxicity in glioblastoma cells: a molecular mechanism study
Article Snippet: .. To generate the linear (L) form, the plasmid was digested with the Pst I restriction enzyme (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol. .. To generate the linear (L) form, the plasmid was digested with the Pst I restriction enzyme (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol.

Incubation:

Article Title: Therapeutic blockade of ER stress and inflammation prevents NASH and progression to HCC
Article Snippet: Briefly, total isolated RNA from livers was reverse-transcribed to cDNA (see qPCR) and primers designed specifically to amplify XBP-1 mRNA across the splice junction (5′ oligo: AAACAGAGTAGCAGCGCAGACTGC, 3′ oligo: GGATCTCTAAAACTAGAGGCTTGGTG) were used in a hot start PCR under the following cycling conditions: 94°C for 30 s (initial denaturation), 94°/51°/68°C for 30/30/60 s, 30 cycles (denaturation/annealing/extension) and 68°C for 5 min (final extension) using 5 μl of cDNA (Hot start Taq DNA Polymerase, NEB, M0495S). .. Incubation of the amplicon at 4°C occurred for 5 min before the addition of 25 μl of the Pst I restriction enzyme in restriction buffer with nuclease-free water (Pst I–HF, NEB, and R0410S) and incubation at 37°C for 15 min. .. The restriction reaction was terminated by the addition of 10 μl of 6× loading dye at room temperature, and the entire 50 μl of digested cDNA was run on a 1.5% agarose gel in 1× tris-acetate-EDTA buffer against a 100–base pair DNA ladder (N3231S, NEB).

Article Title: Therapeutic blockade of ER stress and inflammation prevents NASH and progression to HCC.
Article Snippet: Briefly, total isolated RNA from livers was reverse-transcribed to cDNA (see qPCR) and primers designed specifically to amplify XBP-1 mRNA across the splice junction (50 oligo: AAACAGAGTAGCAGCGCAGACTGC, 30 oligo: GGATCTCTAAAACTAGAGGCTTGGTG) were used in a hot start PCR under the following cycling conditions: 94°C for 30 s (initial denaturation), 94°/51°/68°C for 30/30/60 s, 30 cycles (denaturation/annealing/extension) and 68°C for 5 min (final extension) using 5 μl of cDNA (Hot start Taq DNA Polymerase, NEB, M0495S). .. Incubation of the amplicon at 4°C occurred for 5 min before the addition of 25 μl of the Pst I restriction enzyme in restriction buffer with nuclease-free water (Pst I–HF, NEB, and R0410S) and incubation at 37°C for 15 min. .. The restriction reaction was terminated by the addition of 10 μl of 6× loading dye at room temperature, and the entire 50 μl of digested cDNA was run on a 1.5% agarose gel in 1× tris-acetate-EDTA buffer against a 100–base pair DNA ladder (N3231S, NEB).

Article Title: Ice holes microrefugia harbor genetically and functionally distinct populations of Vaccinium vitis-idaea (Ericaceae)
Article Snippet: DNA was extracted from 50 mg of dry material from each individual plant using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) with addition of up to 3.1% polyvinylpyrrolidone (PVP) to the AP1 lysis buffer to enhance the final yield. .. The samples were incubated overnight at 65 °C with the mixed buffer and RNase A . RAD libraries were prepared using the Pst I restriction enzyme (New England Biolabs, NEB, Ipswich, MA, USA) adapting a protocol that was described in previous studies , . ..

Amplification:

Article Title: A Large Cohort of Hemoglobin Variants in Thailand: Molecular Epidemiological Study and Diagnostic Consideration
Article Snippet: .. An α2 specific amplification was done using primers αG39 ( 5′-ACTCTTCTGGTCCCCACAGAC-3′ ) and C3 ( 5′-CCATTGTTGGCACATTCCGG-3′ ) and the amplified product was digested to completion with Pst I restriction enzyme (5′-CTGCA ▾ G-3′) (New England Biolabs, Beverly, MA, USA). ..

Polymerase Chain Reaction:

Article Title: Mutational scanning reveals substrate-assisted autoregulation of the WNT destruction complex
Article Snippet: .. The PCR product was then digested with the Pst I restriction enzyme (New England Biolabs) to confirm the introduction of the silent mutation and thus the intended HDR event. ..

Mutagenesis:

De-Phosphorylation Assay:

Article Title: Risk assessment of plant-to-bacterium transgene flow associated with novel small synthetic genome (minisynplastome) platforms for plastid genetic engineering
Article Snippet: .. The Gen2 minisynplastome in linear form was obtained by restriction digestion using the Pst I restriction enzyme followed by dephosphorylation of 5′ ends using the calf intestinal phosphatase (New England Biolabs, NEB). ..

Review